AccuGreen Standard 2, 10 ng/uL

We compared different methods (absorbance, fluorescent dye binding and digital PCR) for measuring concentrations of human genomic DNA from cultured cells and absorbance measurements of a synthetic DNA oligonucleotide. NIST Standard Reference Material (SRM) 2082, a pathlength absorbance standard, was used to evaluate absorbance measurements made with microvolume spectrophotometers and a microvolume plate reader. Control absorbance values ​​were measured using a high-precision spectrophotometer and a NIST-calibrated pathlength cuvette.

 Measurements of the human genomic DNA sample were performed with several types of fluorescent dye binding assays using different DNA calibrators. 

The fluorescent dye binding methods gave different results for genomic DNA depending on the type of DNA calibrator and the fluorescent dye used. The human genomic DNA sample was also characterized using six different digital droplet PCR assays (amplicons on different chromosomes) to measure mean copy number. The conversion of the digital PCR data into copy numbers was sensitive to the droplet size used for calculations, and the conversion into mass concentration was dependent on the molecular weight of the human genome used for the calculations. The results of the different methods were compared and the caveats for each measurement method were discussed.and the conversion to mass concentration was dependent on the molecular weight of the human genome used for the calculations. The results of the different methods were compared and the caveats for each measurement method were discussed. The conversion of the digital PCR data into copy numbers was sensitive to the droplet size used for calculations, and the conversion into mass concentration was dependent on the molecular weight of the human genome used for the calculations. The results of the different methods were compared and the caveats for each measurement method were discussed.

  • Accurate and reproducible measurements of human genomic DNA sample concentrations are essential to obtain reliable results obtained from PCR and genome sequencing methods
  • Accurately determining the concentration of human genomic DNA is an essential task, but achieving it requires an understanding of the limitations of the methods used and the sample preparation methods needed to obtain reproducible results. This task is complicated by the chemical and physical complexity of genomic DNA and the variety of sample preparation methods. Storage conditions can change the physical properties of the materials, which can affect how the samples behave with different measurement methods.
  • Nucleic acid concentrations are routinely measured by absorbance, fluorescent dye binding, and digital PCR methods. The simplest and fastest method is probably direct  measurements of nucleic acids at 260 nm with relatively simple instruments.
  • New spectrophotometers using short pathlengths can measure the absorbance of microliter-sized samples to preserve samples. Sensitive assays (compared to absorbance methods) using fluorescent dyes have been developed to specifically measure double-stranded or single-stranded nucleic acids. Digital PCR is fast becoming an important method due to its sensitivity, specificity, and dynamic range for a variety of nucleic acid samples.
  •  Researchers are studying digital PCR to determine the best ways to reliably quantify the concentration of DNA samples. The accessibility of some human genomic DNA targets can be increased by restriction enzyme fragmentation, but treatments can also reduce the number of targets in some cases .
  •  NIST has developed methods to  more accurately measure targets per volume and droplet volumes. Control samples and reference materials are necessary to ensure that sample processing, analytical methods, and instruments are functioning correctly.
  • DNA derived from human cell lines modified to immortalize the cells are renewable sources of material. The NIST-led Genome in a Bottle public-private consortium is developing human genomic DNA reference materials (derived from cell lines) as well as well-annotated reference materials for benchmarking DNA sequencing methods.

Our goals in this study were to compare the different methods of measuring the concentration of nucleic acids for internal DNA controls and to identify the sources of variability in these measurements.

Materials and methods

A DNA oligonucleotide (10 micromol scale) was ordered from Eurofins MWG Operon LLC (Louisville, KY) with the sequence TCCTCAAGGCTAGCACTGTTC (21 bases, 52.4% GC content) and a molecular weight of 6357.2. The dried salt-free oligonucleotide was dissolved in 50 ml of a buffer consisting of 10 mmol/l TRIS 1 mmol/l EDTA pH 8.0 (TE buffer) to prepare samples, which were designated high concentration oligonucleotide (Oligo High). A portion of the Oligo High sample (10 mL) was diluted to a final volume of 40 mL using TE buffer to prepare the solution (Oligo Low). The oligonucleotide samples were dispensed into tubes and stored at -20°C. These samples were brought to ambient temperature (approximately 30 minutes) and then vortexed to achieve a uniform solution. The thawed samples can be stored at 4°C for at least 1 month.

Human genomic DNA (gDNA) was obtained from the Coriell Institute for Medical Research (Camden, NJ). Purified human male DNA (NA24385) was prepared from the Coriell Institute for Medical Research cell line GM24385. The NIST Human Subject Protection Office has reviewed and approved the use of this human cell line derived material. NIST Reference Material (RM) 8391 is made from the same cell line source, but our samples were obtained directly from the Coriell Institute for Medical Research. The concentrated DNA stock solution was diluted 10-fold with TE buffer and the resulting solutions (approximately 50 µg/ml) were dispensed into individual tubes (0.05 ml) and stored at 4°C. The sample was gently mixed to help obtain consistent measurements.

Reference values ​​of SRM 2082, human genomic DNA and synthetic oligonucleotides

NIST Standard Reference Material (SRM) 2082 contains three solutions: a blank consisting of 10 mmol/L 2-amino-2-hydroxymethyl-propane-1,3-diol, pH 8.0 buffer (TRIS buffer); tryptophan in TRIS buffer; and uracil in TRIS buffer. SRM 2082 was stored at -20°C. It was brought to ambient temperature by keeping the vials at room temperature (approximately 30 min) and then resuspended by inverting the vials at least 20 times to ensure a uniform solution. The suspended solutions can be stored at 4°C for at least 3 months. NIST SRM 2082 tryptophan and uracil solution reference values ​​were determined using NIST calibrated cuvettes (0.1 mm to 2 mm) using a Cary 6000i dual-beam spectrophotometermeasured with a spectral bandwidth of 0.8 nm and a temperature of 22 °C (  ). The samples were scanned from 340 nm to 240 nm (1 nm resolution) and the buffer blanks were subtracted from the samples. The absorbance values ​​for the oligo low concentration, oligo high concentration, and human genomic DNA (gDNA) samples were determined using three separate samples in NIST-calibrated cuvettes (0.5115 mm) at a temperature of 22 °C and one spectral bandwidth of 0.8 nm measured on a Cary 6000i spectrophotometer and a Perkin Elmer Lambda 900s spectrophotometer.

Micro volume spectrophotometer and cuvettes

Samples were measured on various microliter volume (MV) spectrophotometers including Nanodrop One C (Thermo Scientific, Willington, DE, USA), UV5Nano (Mettler Toledo, Columbus, OH, USA) and NanoPhometer NP-80 (IMPLEN, Westlake Dorf, CA, US). The instruments were operated at ambient temperature (22°C) using the default settings. The MV spectrophotometers were checked to ensure that they were performing according to the manufacturer’s specifications.

A BioTek Synergy MX plate reader with a Take3 microvolume plate was used according to the operating and calibration procedures provided by the manufacturer. A basic system test was performed and evaluated to confirm the full functionality of the motors, lamp, PMT and various reader subsystems. A calibrated absorbance test plate was used to confirm mechanical alignment, including optical density accuracy, linearity, repeatability, and wavelength accuracy.

AccuGreenâ„¢ Standard 2, 10 ng/uL

99820-T Biotium 1ML 93 EUR

AccuGreenâ„¢ Standard 2, 100 ng/uL

99838-T Biotium 1ML 93 EUR

AccuClear dsDNA Standard, 25 ng/uL

31029C Biotium 1mL 93 EUR

GFP Antibody, 10 uL

P601-10 101Bio - Ask for price

Human Plasma Progesterone standard (100 ng/ml)

1955-P4-10 Alpha Diagnostics 10 ml Ask for price

Human Plasma Progesterone standard (0 ng/ml)

1955-P4-00 Alpha Diagnostics 10 ml Ask for price

Human Plasma Progesterone standard (100 ng/ml)

1955-P4-1 Alpha Diagnostics 1 ml Ask for price

Single channel mini-pipette (130 mm) 10 ul, autoclavable

SCMP-10 Alpha Diagnostics 1 92 EUR

NG-amino-L-Arginine (hydrochloride)

C4069-10 ApexBio 10 mg 158 EUR

Polystyrene Particle Size Standard

PPS-2 Spherotech mL 127 EUR

T4 RNA Ligase, 10-20u/ul

BEL0021 Bio Basic 1KU 168.9 EUR

Lyophilized recombinant standard

ST0000-10 BosterBio 10ng/vial 172 EUR

Disposable yellow pipette tips (1-200 ul) for meat sample (10 box 96 tips)

YPT96-10 Alpha Diagnostics 1 pk 152 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 2 vials)

M1040-2 Biovision 593 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, Human Plasma, 2 vials)

M1041-2 Biovision 711 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, Human Serum, 2 vials)

M1042-2 Biovision 599 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, Human Serum, 2 vials)

M1043-2 Biovision 713 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, Human Urine, 2 vials)

M1044-2 Biovision 599 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, Human Urine, 2 vials)

M1045-2 Biovision 707 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, Human Saliva, 2 vials)

M1046-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, Human Saliva, 2 vials)

M1047-2 Biovision 729 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 2 vials)

M1054-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 2 vials)

M1055-2 Biovision 718 EUR

Albumin-X, Albumin (multiple species) removal kit (sufficient to remove 2-3 mg albumin or process ~50-100 ul serum; 10 mini-columns ~250 ul resin)

700-300-10 Alpha Diagnostics 1 kit 286 EUR

NG,NG-dimethyl-L-Arginine (hydrochloride)

C5216-25 ApexBio 25 mg 170 EUR

NG,NG-dimethyl-L-Arginine (hydrochloride)

C5216-50 ApexBio 50 mg 261 EUR

Cyanine3 azide, 100 uL, 10 mM/DMSO

11030 Lumiprobe 10 mM/DMSO 108 EUR

Cyanine3.5 azide, 100 uL, 10 mM/DMSO

12030 Lumiprobe 100 µl 108 EUR

Cyanine5 azide, 100 uL, 10 mM/DMSO

13030 Lumiprobe 100 µl 108 EUR

Cyanine5.5 azide, 100 uL, 10 mM/DMSO

14030 Lumiprobe 100 µl 108 EUR

Cyanine7 azide, 100 uL, 10 mM/DMSO

15030 Lumiprobe 100 µl 108 EUR

Cyanine7.5 azide, 100 uL, 10 mM/DMSO

16030 Lumiprobe 100 µl 108 EUR

Cyanine5.5 azide, 500 uL, 10 mM/DMSO

34030 Lumiprobe 500 µl 182 EUR

Cyanine7 azide, 500 uL, 10 mM/DMSO

35030 Lumiprobe 500 µl 182 EUR

Cyanine7.5 azide, 500 uL, 10 mM/DMSO

36030 Lumiprobe 500 µl 182 EUR

Cyanine3 azide, 500 uL, 10 mM/DMSO

31030 Lumiprobe 10 mM/DMSO 182 EUR

Cyanine3.5 azide, 500 uL, 10 mM/DMSO

32030 Lumiprobe 500 µl 182 EUR

Cyanine5 azide, 500 uL, 10 mM/DMSO

33030 Lumiprobe 500 µl 182 EUR

NG 52

HY-15154 MedChemExpress 50mg 1214 EUR

NG 012

GL9289-1MG Glentham Life Sciences 1 mg 218 EUR

NG 012

GL9289-5MG Glentham Life Sciences 5 mg 665 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, COLO1 cell line, 2 vials)

M1048-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, COLO1 cell line, 2 vials)

M1049-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, MM1 cell line, 2 vials)

M1050-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, MM1 cell line, 2 vials)

M1051-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, BLCL21 cell line, 2 vials)

M1052-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, BLCL21 cell line, 2 vials)

M1053-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, HCT116 cell line, 2 vials)

M1058-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, HCT116 cell line, 2 vials)

M1059-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, PC3 cell line, 2 vials)

M1060-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, PC3 cell line, 2 vials)

M1061-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, DAUD1 cell line, 2 vials)

M1064-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, DAUD1 cell line, 2 vials)

M1065-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, A549 cell line, 2 vials)

M1066-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, A549 cell line, 2 vials)

M1067-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, B16F10 cell line, 2 vials)

M1070-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, B16F10 cell line, 2 vials)

M1071-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, BPH-1 cell line, 2 vials)

M1062-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, BPH-1 cell line, 2 vials)

M1063-2 Biovision 718 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, K-562 cell line, 2 vials)

M1068-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, K-562 cell line, 2 vials)

M1069-2 Biovision 718 EUR

FDA Standard Frozen Tissue Array - Mouse Normal

T6334701-2 Biochain 4 slides 1041 EUR

FDA Standard Frozen Tissue Array - Rat Normal

T6434701-2 Biochain 4 slides 1041 EUR

Agarose Standard 50bp - 50.000 bp

604-005-2 GeneOn 2x500g 339 EUR

SureCount Particle Count Standard ( 3um)

CC03N-10 Bangs Laboratories 10 ml 344.29 EUR

SureCount Particle Count Standard ( 5um)

CC05N-10 Bangs Laboratories 10 ml 344.29 EUR

SureCount Particle Count Standard (10um)

CC10N-10 Bangs Laboratories 10 ml 344.29 EUR

SureCount Particle Count Standard (15um)

CC15N-10 Bangs Laboratories 10 ml 344.29 EUR

ExoStd? Lyophilized Exosome Standard (30 µg, SK-N-SH cell line, 2 vials)

M1056-2 Biovision 604 EUR

ExoStd? Lyophilized Exosome Standard (100 µg, SK-N-SH cell line, 2 vials)

M1057-2 Biovision 718 EUR

FDA Standard Frozen Tissue Array - Human Adult Normal

T6234701-2 Biochain 4 slides 2034 EUR

IL-10 Interleukin-10 Human Recombinant Protein

PROTP22301-2 BosterBio Regular: 10ug 317 EUR

pTALEN- V2 NG

PVT10906 Lifescience Market 2 ug 301 EUR

pTALETF_v2 NG Plasmid

PVT6205 Lifescience Market 2 ug 266 EUR

pTALEN_v2 NG Plasmid

PVT6209 Lifescience Market 2 ug 266 EUR

Standard Rabbit Complement serum (Lyophilized), tested for complement activity

COMPR-2 Alpha Diagnostics 2 ml 286 EUR

ROX azide, 5- isomer, 100 uL, 10 mM/DMSO

11230 Lumiprobe 100 µl 108 EUR

FAM azide, 5-isomer, 100 uL, 10 mM/DMSO

14130 Lumiprobe 100 ul 75 EUR

R6G azide, 5-isomer, 100 uL, 10 mM/DMSO

14430 Lumiprobe 100 µl 108 EUR

FAM azide, 6-isomer, 100 uL, 10 mM/DMSO

15130 Lumiprobe 100 ul 75 EUR

TAMRA azide, 5-isomer, 100 uL, 10 mM/DMSO

17130 Lumiprobe 100 µl 108 EUR

FAM azide, 5-isomer, 500 uL, 10 mM/DMSO

34130 Lumiprobe 500 ul 86 EUR

R6G azide, 5-isomer, 500 uL, 10 mM/DMSO

34430 Lumiprobe 500 µl 182 EUR

FAM azide, 6-isomer, 500 uL, 10 mM/DMSO

35130 Lumiprobe 500 ul 86 EUR

TAMRA azide, 5-isomer, 500 uL, 10 mM/DMSO

37130 Lumiprobe 500 µl 182 EUR

ROX azide, 5- isomer, 500 uL, 10 mM/DMSO

31230 Lumiprobe 500 µl 182 EUR

Agarose Standard 50bp - 50.000 bp

604-005-10 GeneOn 10x500g 1329 EUR

CXCL10/IP-10/CRG-2, human recombinant

4277-10 Biovision 185 EUR

2-Propyl-β-D-glucuronide, 10 mg

0904-10 AthenaES 10 mg 554 EUR

T-2 Toxin Standard

SD012 Unibiotest 0.5ug/mL 607 EUR

HT-2 Toxin Standard

SD014 Unibiotest 0.5ug/mL 607 EUR

Pig AORTA 10 EA*

59402-2 Pel-Freez 10 EA 249.88 EUR

Pig PANCREAS 10 EA*

59431-2 Pel-Freez 10 EA 318.39 EUR

PG THYMUS 10 EA*

59451-2 Pel-Freez 10 EA 353.19 EUR

CK THYROID 10 EA*

43052-2 Pel-Freez 10 EA 260.75 EUR

99445-10 DCT 10 X 75MM

99445-10 CORNING 250/pk 63 EUR

1730 10 SNAP-SEAL 10 OZ

1730-10 CORNING 100/pk 80 EUR

GSA 10

B5767-10 ApexBio 10 mg 229 EUR

SC-10

B6299-10 ApexBio 10 mg 213 EUR

MRT 10

B7685-10 ApexBio 10 mg 238 EUR

 An absorbance liquid test was performed to confirm the repeatability and alignment of the reader when using a solution in a microplate. Briefly, 2 µl of each buffer was loaded onto the microspot slide and blanked. Both the microspot slide and the top slide were cleaned with a dry lab wipe and deionized water. Samples of interest were loaded onto the microspot slide and the absorbance measured using the recommended wavelengths relative to the sample type. All values ​​were imported via Gen5 software and exported to Excel for analysis. Corrected pathlength and background values ​​were used to calculate normalized absorbance.

Leave a Comment