AccuGreen Standard 2, 10 ng/uL

We compared different methods (absorbance, fluorescent dye binding and digital PCR) for measuring concentrations of human genomic DNA from cultured cells and absorbance measurements of a synthetic DNA oligonucleotide. NIST Standard Reference Material (SRM) 2082, a pathlength absorbance standard, was used to evaluate absorbance measurements made with microvolume spectrophotometers and a microvolume plate reader. Control absorbance values ​​were measured using a high-precision spectrophotometer and a NIST-calibrated pathlength cuvette.

 Measurements of the human genomic DNA sample were performed with several types of fluorescent dye binding assays using different DNA calibrators. 

The fluorescent dye binding methods gave different results for genomic DNA depending on the type of DNA calibrator and the fluorescent dye used. The human genomic DNA sample was also characterized using six different digital droplet PCR assays (amplicons on different chromosomes) to measure mean copy number. The conversion of the digital PCR data into copy numbers was sensitive to the droplet size used for calculations, and the conversion into mass concentration was dependent on the molecular weight of the human genome used for the calculations. The results of the different methods were compared and the caveats for each measurement method were discussed.and the conversion to mass concentration was dependent on the molecular weight of the human genome used for the calculations. The results of the different methods were compared and the caveats for each measurement method were discussed. The conversion of the digital PCR data into copy numbers was sensitive to the droplet size used for calculations, and the conversion into mass concentration was dependent on the molecular weight of the human genome used for the calculations. The results of the different methods were compared and the caveats for each measurement method were discussed.

  • Accurate and reproducible measurements of human genomic DNA sample concentrations are essential to obtain reliable results obtained from PCR and genome sequencing methods
  • Accurately determining the concentration of human genomic DNA is an essential task, but achieving it requires an understanding of the limitations of the methods used and the sample preparation methods needed to obtain reproducible results. This task is complicated by the chemical and physical complexity of genomic DNA and the variety of sample preparation methods. Storage conditions can change the physical properties of the materials, which can affect how the samples behave with different measurement methods.
  • Nucleic acid concentrations are routinely measured by absorbance, fluorescent dye binding, and digital PCR methods. The simplest and fastest method is probably direct  measurements of nucleic acids at 260 nm with relatively simple instruments.
  • New spectrophotometers using short pathlengths can measure the absorbance of microliter-sized samples to preserve samples. Sensitive assays (compared to absorbance methods) using fluorescent dyes have been developed to specifically measure double-stranded or single-stranded nucleic acids. Digital PCR is fast becoming an important method due to its sensitivity, specificity, and dynamic range for a variety of nucleic acid samples.
  •  Researchers are studying digital PCR to determine the best ways to reliably quantify the concentration of DNA samples. The accessibility of some human genomic DNA targets can be increased by restriction enzyme fragmentation, but treatments can also reduce the number of targets in some cases .
  •  NIST has developed methods to  more accurately measure targets per volume and droplet volumes. Control samples and reference materials are necessary to ensure that sample processing, analytical methods, and instruments are functioning correctly.
  • DNA derived from human cell lines modified to immortalize the cells are renewable sources of material. The NIST-led Genome in a Bottle public-private consortium is developing human genomic DNA reference materials (derived from cell lines) as well as well-annotated reference materials for benchmarking DNA sequencing methods.

Our goals in this study were to compare the different methods of measuring the concentration of nucleic acids for internal DNA controls and to identify the sources of variability in these measurements.

Materials and methods

A DNA oligonucleotide (10 micromol scale) was ordered from Eurofins MWG Operon LLC (Louisville, KY) with the sequence TCCTCAAGGCTAGCACTGTTC (21 bases, 52.4% GC content) and a molecular weight of 6357.2. The dried salt-free oligonucleotide was dissolved in 50 ml of a buffer consisting of 10 mmol/l TRIS 1 mmol/l EDTA pH 8.0 (TE buffer) to prepare samples, which were designated high concentration oligonucleotide (Oligo High). A portion of the Oligo High sample (10 mL) was diluted to a final volume of 40 mL using TE buffer to prepare the solution (Oligo Low). The oligonucleotide samples were dispensed into tubes and stored at -20°C. These samples were brought to ambient temperature (approximately 30 minutes) and then vortexed to achieve a uniform solution. The thawed samples can be stored at 4°C for at least 1 month.

Human genomic DNA (gDNA) was obtained from the Coriell Institute for Medical Research (Camden, NJ). Purified human male DNA (NA24385) was prepared from the Coriell Institute for Medical Research cell line GM24385. The NIST Human Subject Protection Office has reviewed and approved the use of this human cell line derived material. NIST Reference Material (RM) 8391 is made from the same cell line source, but our samples were obtained directly from the Coriell Institute for Medical Research. The concentrated DNA stock solution was diluted 10-fold with TE buffer and the resulting solutions (approximately 50 µg/ml) were dispensed into individual tubes (0.05 ml) and stored at 4°C. The sample was gently mixed to help obtain consistent measurements.

Reference values ​​of SRM 2082, human genomic DNA and synthetic oligonucleotides

NIST Standard Reference Material (SRM) 2082 contains three solutions: a blank consisting of 10 mmol/L 2-amino-2-hydroxymethyl-propane-1,3-diol, pH 8.0 buffer (TRIS buffer); tryptophan in TRIS buffer; and uracil in TRIS buffer. SRM 2082 was stored at -20°C. It was brought to ambient temperature by keeping the vials at room temperature (approximately 30 min) and then resuspended by inverting the vials at least 20 times to ensure a uniform solution. The suspended solutions can be stored at 4°C for at least 3 months. NIST SRM 2082 tryptophan and uracil solution reference values ​​were determined using NIST calibrated cuvettes (0.1 mm to 2 mm) using a Cary 6000i dual-beam spectrophotometermeasured with a spectral bandwidth of 0.8 nm and a temperature of 22 °C (  ). The samples were scanned from 340 nm to 240 nm (1 nm resolution) and the buffer blanks were subtracted from the samples. The absorbance values ​​for the oligo low concentration, oligo high concentration, and human genomic DNA (gDNA) samples were determined using three separate samples in NIST-calibrated cuvettes (0.5115 mm) at a temperature of 22 °C and one spectral bandwidth of 0.8 nm measured on a Cary 6000i spectrophotometer and a Perkin Elmer Lambda 900s spectrophotometer.

Micro volume spectrophotometer and cuvettes

Samples were measured on various microliter volume (MV) spectrophotometers including Nanodrop One C (Thermo Scientific, Willington, DE, USA), UV5Nano (Mettler Toledo, Columbus, OH, USA) and NanoPhometer NP-80 (IMPLEN, Westlake Dorf, CA, US). The instruments were operated at ambient temperature (22°C) using the default settings. The MV spectrophotometers were checked to ensure that they were performing according to the manufacturer’s specifications.

A BioTek Synergy MX plate reader with a Take3 microvolume plate was used according to the operating and calibration procedures provided by the manufacturer. A basic system test was performed and evaluated to confirm the full functionality of the motors, lamp, PMT and various reader subsystems. A calibrated absorbance test plate was used to confirm mechanical alignment, including optical density accuracy, linearity, repeatability, and wavelength accuracy.

AccuGreen™ Standard 2, 10 ng/uL

99820-T Biotium 1ML 48 EUR

AccuGreen™ Standard 2, 10 ng/uL

99820-T-1 Biotium EA 48 EUR

AccuGreen™ Standard 2, 100 ng/uL

99838-T Biotium 1ML 48 EUR

AccuGreen™ Standard 2, 100 ng/uL

99838-T-1 Biotium EA 48 EUR

AccuGreen™ Broad Range dsDNA Quantitation Kit (500 assays)

31069-1 Biotium KT 196 EUR

AccuGreen™ Broad Range dsDNA Quantitation Kit (100 assays)

31069-T Biotium 1kit 84 EUR

AccuGreen™ Broad Range dsDNA Quantitation Kit (100 assays)

31069-T-1 Biotium KT 84 EUR

AccuGreen High Sensitivity dsDNA Quantitation Kit (20 assays)

31066-F Biotium 20kit 60 EUR

AccuGreen™ High Sensitivity dsDNA Quantitation Kit (500 assays)

31066-1 Biotium KT 261 EUR

AccuGreen™ High Sensitivity dsDNA Quantitation Kit (100 assays)

31066-T Biotium 100kit 93 EUR

AccuGreen™ High Sensitivity dsDNA Quantitation Kit (100 assays)

31066-T-1 Biotium KT 93 EUR

AccuGreen™ Broad Range dsDNA Quantitation Solution (500 assays)

31070-1 Biotium KT 156 EUR

AccuGreen™ Broad Range dsDNA Quantitation Solution (100 assays)

31070-T Biotium 1kit 68 EUR

AccuGreen™ Broad Range dsDNA Quantitation Solution (100 assays)

31070-T-1 Biotium KT 68 EUR

AccuGreen™ High Sensitivity dsDNA Quantitation Solution (500 assays)

31068-1 Biotium KT 173 EUR

AccuGreen™ High Sensitivity dsDNA Quantitation Solution (100 assays)

31068-T Biotium 100kit 75 EUR

AccuGreen™ High Sensitivity dsDNA Quantitation Solution (100 assays)

31068-T-1 Biotium KT 75 EUR

AccuClear® dsDNA Standard, 25 ng/uL

31029C Biotium 1mL 49 EUR

AccuClear® dsDNA Standard, 25 ng/uL

31029C-1 Biotium KT 49 EUR

RNA Broad Range Standard, 100 ng/uL

99850 Biotium 1UL 63 EUR

RNA Broad Range Standard, 100 ng/uL

99850-1 Biotium EA 63 EUR

Human Plasma Progesterone standard (100 ng/ml)

1955-P4-1 Alpha Diagnostics 1 ml Ask for price

Human Plasma Progesterone standard (100 ng/ml)

1955-P4-10 Alpha Diagnostics 10 ml Ask for price

Ep-tips standard 0.5-20 ul - PK1000

Z640085-1000EA Scientific Laboratory Supplies PK1000 78.3 EUR

Human Plasma Progesterone standard (0 ng/ml)

1955-P4-00 Alpha Diagnostics 10 ml Ask for price

Kylt® PCV-2 Standard LD 10

31409 Anicon Labor GmbH each 115.54 EUR

Tip LTS standard version - non-sterile - bulk - volume 5000 uL - PK1000

DD712032 Scientific Laboratory Supplies PK1000 319.95 EUR

pH 10 Buffer Standard 500mL - 500ML

PH-BUFF10-500 Scientific Laboratory Supplies 500ML 51.3 EUR

ICP Instrument Check Standard 10 - 125ML

CALMIX10-100 Scientific Laboratory Supplies 125ML 256.5 EUR

ICP Instrument Check Standard 10 - 500ML

CALMIX10-500 Scientific Laboratory Supplies 500ML 433.35 EUR

2-Phenylethanol (Standard)

HY-B1290R MedChemExpress Get quote Ask for price

2',3'-cGAMP Standard

C296-125UL Arbor Assays 125UL 85 EUR

2',3'-cGAMP Standard

C296-625UL Arbor Assays 625UL 207 EUR

HT-2 Toxin Standard

SD014 Unibiotest 0.5ug/mL 728.4 EUR

Internal Standard 2 - 1ML

CLPV-I2 Scientific Laboratory Supplies 1ML 48.6 EUR

10% B Agarose Bead Standard (50-150 µm)

A-1100S-1000 ABTBeads 1 l 614.4 EUR

10% B Agarose Bead Standard (50-150 µm)

A-1100S-10000 ABTBeads 10 l Ask for price

10% B Agarose Bead Standard (50-150 µm)

A-1100S-500 ABTBeads 500 ml 363.6 EUR

B Agarose Bead Standard (50-150 µm) (10%)

abx291351-100g Abbexa 100 µg Ask for price

B Agarose Bead Standard (50-150 µm) (10%)

abx291351-20g Abbexa 20 µg 537.5 EUR

B Agarose Bead Standard (50-150 µm) (10%)

abx291351-50g Abbexa 50 µg 887.5 EUR

Synthetic Fresh Water Standard 10-13ppm - 5L

HSVS1 Scientific Laboratory Supplies 5L 104.28 EUR

10% BCL Agarose Bead Standard (50-150 µm)

A-1101S-1000 ABTBeads 1 l 708 EUR

10% BCL Agarose Bead Standard (50-150 µm)

A-1101S-10000 ABTBeads 10 l Ask for price

10% BCL Agarose Bead Standard (50-150 µm)

A-1101S-500 ABTBeads 500 ml 388.8 EUR

BCL Agarose Bead Standard (50-150 µm) (10%)

abx291356-100g Abbexa 100 µg Ask for price

BCL Agarose Bead Standard (50-150 µm) (10%)

abx291356-20g Abbexa 20 µg 575 EUR

BCL Agarose Bead Standard (50-150 µm) (10%)

abx291356-50g Abbexa 50 µg 1025 EUR

Synthetic Fresh Water Standard 10-13ppm - 25L

HSVS5 Scientific Laboratory Supplies 25L 330.48 EUR

UOP Method 868 Standard-10 Components - 1ML

UOP-868 Scientific Laboratory Supplies 1ML 569.7 EUR

recombinant IP-10 Standard, 1 vial

M858.130 Tecan Benelux 1 unit 31.26 EUR

AccuClear® Ultra High Sensitivity dsDNA Quantitation Assay kit with 1 DNA Standard (2000 assays)

31029-1 Biotium KT 521 EUR

Hanna Calibration Standard 10 FTU - EACH

WAT1556 Scientific Laboratory Supplies EACH 67.5 EUR

pH 2 Buffer Standard 500mL - 500ML

PH-BUFF2-500 Scientific Laboratory Supplies 500ML 51.3 EUR

Standard

abx098954-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098954-1vial Abbexa 1 vial 360 EUR

Standard

abx098954-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx098955-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098955-1vial Abbexa 1 vial 360 EUR

Standard

abx098955-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx098956-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098956-1vial Abbexa 1 vial 360 EUR

Standard

abx098956-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx098963-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098963-1vial Abbexa 1 vial 360 EUR

Standard

abx098963-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx098965-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098965-1vial Abbexa 1 vial 360 EUR

Standard

abx098965-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx098967-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098967-1vial Abbexa 1 vial 360 EUR

Standard

abx098967-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx098968-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098968-1vial Abbexa 1 vial 360 EUR

Standard

abx098968-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx098969-10vials Abbexa 10 vials 2614.8 EUR

Standard

abx098969-1vial Abbexa 1 vial 360 EUR

Standard

abx098969-5vials Abbexa 5 vials 1412.4 EUR

Standard

abx092106-1vial Abbexa 1 vial 260.4 EUR

Standard

1000363 Phoenix instrument each 130 EUR

Standard

abx296006-1vial Abbexa 1 vial 360 EUR

15-LOX form-2 Standard

MBS483024-100ng MyBiosource 100ng 280 EUR

15-LOX form-2 Standard

MBS483024-5x100ng MyBiosource 5x100ng 1185 EUR

ClearLine 0.1 - 10 uL standard sterile filter tip in removable-lid racks (long tip - length 45 mm) - PK960

DD038000CL Scientific Laboratory Supplies PK960 101.25 EUR

Standard Nutrient Agar No.2

72899 Sisco Laboratories 100 Gms 10.26 EUR

Standard Nutrient Agar No.2

72899-1 Sisco Laboratories 500 Gms 43.62 EUR

Organic Wine Standard 2 - 1ML

WINE-2 Scientific Laboratory Supplies 1ML 128.25 EUR

ICP-MS Internal Standard 2 - 125ML

CLISS-2 Scientific Laboratory Supplies 125ML 437.7 EUR

Kylt® Brachyspira spp Standard LD 10

31841 Anicon Labor GmbH each 115.54 EUR

PHGS-2 Standard, Native Ovine

MBS480646-001mg MyBiosource 0.01mg 235 EUR

PHGS-2 Standard, Native Ovine

MBS480646-5x001mg MyBiosource 5x0.01mg 840 EUR

Density Standard 1.0301g/ml 20C ISO17025 acc 100ml - 100ML

DEN20150 Scientific Laboratory Supplies 100ML 221.4 EUR

AccuBlue® Broad Range dsDNA Quantitation Kit with DNA Standard, trial size (200 assays)

31007-T Biotium 1KIT 68 EUR

AccuBlue® Broad Range dsDNA Quantitation Kit with DNA Standard, trial size (200 assays)

31007-T-1 Biotium KT 68 EUR

Kylt® Influenzavirus A Standard LD 10

31423 Anicon Labor GmbH each 115.54 EUR

Replacement cap, standard blue (GL45), 10/pk.

B3000-CAP Benchmark Scientific 1 each 36.15 EUR

Replacement cap, standard blue (GL32), 10/pk.

B3000-CAP2 Benchmark Scientific 1 PC 34.92 EUR

IKA ROTAVISC SP-10 Standard Spindle - EACH

VIS2184 Scientific Laboratory Supplies EACH 70.2 EUR

2% B Agarose Bead Standard (50-150 µm)

A-1020S-1000 ABTBeads 1 l 549.6 EUR

2% B Agarose Bead Standard (50-150 µm)

A-1020S-10000 ABTBeads 10 l Ask for price

2% B Agarose Bead Standard (50-150 µm)

A-1020S-500 ABTBeads 500 ml 320.4 EUR

B Agarose Bead Standard (50-150 µm) (2%)

abx291347-100g Abbexa 100 µg Ask for price

B Agarose Bead Standard (50-150 µm) (2%)

abx291347-20g Abbexa 20 µg 487.5 EUR

B Agarose Bead Standard (50-150 µm) (2%)

abx291347-50g Abbexa 50 µg 800 EUR

boite de 500 filtres plat standard, 10 mm

ST61A0010D Filtratech 500 8.03 EUR

Standard HA

1000423 Phoenix instrument each 173 EUR

Standard HF

1000433 Phoenix instrument each 171 EUR

2% BCL Agarose Bead Standard (50-150 µm)

A-1021S-1000 ABTBeads 1 l 633.6 EUR

2% BCL Agarose Bead Standard (50-150 µm)

A-1021S-10000 ABTBeads 10 l Ask for price

2% BCL Agarose Bead Standard (50-150 µm)

A-1021S-500 ABTBeads 500 ml 368.4 EUR

BCL Agarose Bead Standard (50-150 µm) (2%)

abx291352-100g Abbexa 100 µg Ask for price

BCL Agarose Bead Standard (50-150 µm) (2%)

abx291352-20g Abbexa 20 µg 550 EUR

BCL Agarose Bead Standard (50-150 µm) (2%)

abx291352-50g Abbexa 50 µg 912.5 EUR

pH Standard Kit (250ml each) - pH 4, 7, 10

DB0415 Bio Basic 1Kit, 250ml 112.2 EUR

ICP Standard Mercury 10% HNO3 1000µg/ml - 100ML

PHG2A6 Scientific Laboratory Supplies 100ML 135 EUR

Standard ORP

2000233 Phoenix instrument each 153 EUR

STANDARD BNC

1000263 Phoenix instrument each 134 EUR

STANDARD DIN

1000273 Phoenix instrument each 154 EUR

AccuBlue® High Sensitivity dsDNA Quantitation Kit with DNA Standard, trial size (200 assays)

31006-T Biotium 1KIT 68 EUR

AccuBlue® High Sensitivity dsDNA Quantitation Kit with DNA Standard, trial size (200 assays)

31006-T-1 Biotium KT 68 EUR

ANP Standard, 125UL

C095-125UL Arbor Assays 125UL 126 EUR

ANP Standard, 625UL

C095-625UL Arbor Assays 625UL 301 EUR

RBP Standard, 240UL

C014-240UL Arbor Assays 240UL 207 EUR

2-Component Organic Standard (Brazil)

POR-2914-F Scientific Laboratory Supplies 1ML 80.22 EUR

PGFM Standard, 125UL

C085-125UL Arbor Assays 125UL 85 EUR

PGFM Standard, 625UL

C085-625UL Arbor Assays 625UL 218 EUR

Standard shelf

TIN-1000702 Phoenix instrument each 44 EUR

Kylt® Lawsonia intracellularis Standard LD 10

31839 Anicon Labor GmbH each 115.54 EUR

Kylt® Mycoplasma hyopneumoniae Standard LD 10

31840 Anicon Labor GmbH each 115.54 EUR

Alternate ASTM Method D6296 Standard-10 Components - 1ML

ASTM-D6296-M Scientific Laboratory Supplies 1ML 606.15 EUR

Desmin Standard

GWB-88229B GenWay Biotech 0.25 mg Ask for price

Emodin (Standard)

HY-14393R MedChemExpress Get quote Ask for price

Human Group 10 Pre-Mixed Standard Panel A

HPX101A Antigenix America 9 Plex 180 EUR

Human Group 10 Pre-Mixed Standard Panel B

HPX101B Antigenix America 7 Plex 180 EUR

ICP Standard Manganese 2-5pc - 100ML

PMN2A2 Scientific Laboratory Supplies 100ML 135 EUR

ICP Standard Strontium 2-5pc - 100ML

PSR2A2 Scientific Laboratory Supplies 100ML 249.7 EUR

ICP Standard Beryllium 2-5pc - 100ML

PBE2A2 Scientific Laboratory Supplies 100ML 237.6 EUR

UOP Method 543 Standard-2 Components - 1ML

UOP-543 Scientific Laboratory Supplies 1ML 305.1 EUR

Estrone (Standard)

HY-B0234R MedChemExpress 100 mg 64.94 EUR

Estriol (Standard)

HY-B0412R MedChemExpress 10 mg 227.28 EUR

Harmane (Standard)

HY-101392R MedChemExpress Get quote Ask for price

Aspirin (Standard)

HY-14654R MedChemExpress 100 mg 43.29 EUR

Standard Diluent

MBS2090462-1Bottle MyBiosource 1Bottle 120 EUR

Horse Serum (10%) in TBS Standard Buffer, Sterile

30611279-1 Bio-WORLD 100 mL 62.91 EUR

Horse Serum (10%) in TBS Standard Buffer, Sterile

30611279-2 Bio-WORLD 250 mL 89.78 EUR

Estriol Standard, 125UL

C236-125UL Arbor Assays 125UL 85 EUR

Estriol Standard, 625UL

C236-625UL Arbor Assays 625UL 207 EUR

Nitrate Standard, 200UL

C086-200UL Arbor Assays 200UL 85 EUR

Nitrite Standard, 200UL

C087-200UL Arbor Assays 200UL 85 EUR

Estrone Standard, 125UL

C110-125UL Arbor Assays 125UL 85 EUR

Estrone Standard, 625UL

C110-625UL Arbor Assays 625UL 218 EUR

ICP-MS Alternate Internal Standard 2 - 125ML

CL-ISM2-100 Scientific Laboratory Supplies 125ML 521.42 EUR

Naproxen standard

DAGS083 Creative Diagnostics 250 mg 640.5 EUR

Atropine (Standard)

HY-B1205R MedChemExpress 1 mg 108.23 EUR

Orlistat (Standard)

HY-B0218R MedChemExpress 1 mg 71.43 EUR

Probucol (Standard)

HY-B0388R MedChemExpress 100 mg 75.76 EUR

Atenolol (Standard)

HY-17498R MedChemExpress Get quote Ask for price

Lysozyme standard

SH0174 Jiaxing Korain Biotech Ltd (BT Labs) 2mg 30 EUR

Internal Standard

507-I Scientific Laboratory Supplies 1ML 105.84 EUR

Internal Standard

5252-I Scientific Laboratory Supplies 1ML 59.15 EUR

 An absorbance liquid test was performed to confirm the repeatability and alignment of the reader when using a solution in a microplate. Briefly, 2 µl of each buffer was loaded onto the microspot slide and blanked. Both the microspot slide and the top slide were cleaned with a dry lab wipe and deionized water. Samples of interest were loaded onto the microspot slide and the absorbance measured using the recommended wavelengths relative to the sample type. All values ​​were imported via Gen5 software and exported to Excel for analysis. Corrected pathlength and background values ​​were used to calculate normalized absorbance.

Leave a Comment